Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15059F8
Clone ID IST15059F8
Vector VICTR80
Project tigm

Sequence tag IST15059F8HMF1
Sequence
TTGCTATCATATCAGGTGGACATATTTAGCTGTTCCTCTCTGACAAGAATCCTCAAAGCCTTTATAAAACATTAGGAAAT
AAATACTACCCTTCTTTGCTAAACTATTGACTAGTTTTGAGCTTAACACAGTCCTAAAATAAGAACACCAGCAGCAATCC
CAAGCTTAGCTTCAACAGTGGAGTTTTATGCTAAGGTCTCCTCTCAGCTACTTAGTGCTCTAAATAAAGGGGGTTGGGAG
TAGCAGCCCTTCCAGAAGCCAGGCAGGTTGGACTTGACAACCTTGCATTCCTATAACTACAGTGGGAGATCACTTTGCTA
AATGTTACTCACTTTTTCTGGTCTACGGGTGGAGTTACTGAAACTGCCAATTCTAGGGCTCAGACGGTTCCTGTAAAAGC
AGCCTTCAACGCATCGGAAAGACTTTCCTGGAGGAAGGAGCGCTGGCTCNATTTGTCTTTCTGGANTTACTGNGCTCGTT
AATTNANGTGCTCTGANNNTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53954863..53955358 486
NO GENE  


Sequence tag IST15059F8HMR1
Sequence
AGCAAATGTCTTATTTTATTAAACATTAAATTGTTTTATTATTTTATTGTTTTTATCCTATTTTTTTCCTAAGTAGAGCA
TTTTCCTTTGTACCTAAGAGGAACAGTATTTGCAGTGGTCCTCTACAACACCCTCTCTGATGATCAAGGTCAAAAATCAA
ATAAGCCCTCAATTCGGAGGCTGTAAGTCATTCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53955354..53955550 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]


Sequence tag IST15059F8BBF1
Sequence
TTGCTATCATATCAGGTGGACATATTTAGCTGTTCCTCTCTGACAAGAATCCTCAAAGCCTTTATAAAACATTAGGAAAT
AAATACTACCCTTCTTTGCTAAACTATTGACTAGTTTTGAGCTTAACACAGTCCTAAAATAAGAACACCAGCAGCAATCC
CAAGCTTAGCTTCAACAGTGGAGTTTTATGCTAAGGTCTCCTCTCAGCTACTTAGTGCTCTAAATAAAGGGGGTTGGGAG
TAGCAGCCCTTCCAGAAGCCAGGCAGGTTGGACTTGACAACCTTGCATTCCTATAACTACAGTGGGAGATCACTTTGCTA
AATGTTACTCACTTTTTCTGGTCTACGGGTGGAGTTACTGAAACTGCCAATTCTAGGGCTCANACGGTTCCTGTNAAAGC
ANCCNTNANCGCATCGGANAGANTTTCCTGGANGAANGANCNCTGGCTCCATTTGTCTTTCTGGANTNACTGGGCNCGTT
AANTCAGGTGCTCTGATNNNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53954862..53955358 465
NO GENE  

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es