Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0594
Clone ID AD0594
Vector pGT0lxr
Project sanger

Sequence tag AD0594
Sequence
ACTCTTTTTGTTTGTTTTCTTTTTTCATTTTTCAGAGAGGCGGAAACACAGGCAGAAATAAGAGAGATGAAGCAAAGGAT
GATGGAAATGGAGACACAGAACCAGATCAATAGTAACCAACTTCGAAGAGCGGAGCAAGAGGTGAACAGTCTGCAGGAGA
AGGTGTGCTCGCTGTCTGTGAAGAACTAGGGCTTGCTTGCCCAGTTAAGTGAGGCAAAGCGCAGACAGGCAGAGATTGAA
TGCAAGAACGAGGAGGAAGTCATGGCTGTGCGGCTCCGGGAAGCTGATAGCATCGCGGCCGTGGCTGAGCTGCAGCAGCA
CATTGCTGAGCTTGAAATCCAG
Sequence Type mRNA
Unitrap ID UNI2907

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108217218..108224783 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011831 (Evi5) NM_007964 ecotropic viral integration site 5 Gene [Source:MGI (curated);Acc:Evi5-001]

 
Come back to gene ENSMUSG00000011831


For any suggestions or comments, please send an email to unitrap@crg.es