Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2311-NR
Clone ID PST2311-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2311-NR
Sequence
GGACATATGAGGAAATAACATTTTAATACAGCAAGGCTCATTTCCTGTTTTAGAAGATATACAGTAGGGCTAGCGAGATG
GCTCAGTAAGTAAAGGTATGTGAAGGTACAGGCCTGATGACCTGGGTTCATCCCTAAGGACCACCCACAACTAGTTCTCT
GACCTCTGTATGTATGTTTTTAAAGAAAAACATACTGAATTATTTGAATATAGGTATTATCTTGTATATAAAATTTAATT
TCATATGGTTGAAAACAATAGATGT
Sequence Type genomic DNA
Unitrap ID UNI15717

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21265681..21265945 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029014 (Dnajc2) NM_009584 DnaJ (Hsp40) homolog, subfamily C, member 2 Gene [Source:MGI (curated);Acc:Dnajc2-006]

 
Come back to gene ENSMUSG00000029014


For any suggestions or comments, please send an email to unitrap@crg.es