Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2093-NR
Clone ID PST2093-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2093-NR
Sequence
GTTAGGCCCACAAACCACTTGCTTGTTTTCACCACCTTGCCATCATCTTGTGTGAGACCCATGGGCAAGGAACCCTGTGG
GTAACATG
Sequence Type genomic DNA
Unitrap ID UNI1266

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106564193..106564280 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040813 (Tex264) NP_035703 testis expressed gene 264 Gene [Source:MGI Symbol;Acc:MGI:1096570]

 
Come back to gene ENSMUSG00000040813


For any suggestions or comments, please send an email to unitrap@crg.es