Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11549H7
Clone ID IST11549H7
Vector VICTR76
Project tigm

Sequence tag IST11549H7HMR1
Sequence
GGTATATTGTAGCATTCATTTTGAAATACTTCATTTACATTCATTATATACATAGCCNTTAGAAGAT
Sequence Type genomic DNA
Unitrap ID UNI28091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10493092..10493158 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062078 (Qk) NM_021881 quaking Gene [Source:MGI Symbol;Acc:MGI:97837]

 
Come back to gene ENSMUSG00000062078


For any suggestions or comments, please send an email to unitrap@crg.es