Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13433B2
Clone ID IST13433B2
Vector VICTR74
Project tigm

Sequence tag IST13433B2HMF1
Sequence
ATGGTAACATCTCAGGAGAAAACAGGCAGTCAAGCTGGAGCCAAAGGCTCCACCTTTTCCTGCAGCAAGTGCAAATATAA
GACCATCCCTCCTGTCCTGGGTTAAAAGCCTATGATCAACTCTCCCCCAATGAAGCTTAAAAGAAACGTGGTACACACAT
TTATTTGCTCTTCTGCAACACACCCTGCCCCTCCCTCACCACCTCTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI30459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98498744..98498955 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031302 (Nlgn3) NM_172932 neuroligin 3 Gene [Source:MGI (curated);Acc:Nlgn3-002]

 
Come back to gene ENSMUSG00000031302


For any suggestions or comments, please send an email to unitrap@crg.es