Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12010G2
Clone ID IST12010G2
Vector VICTR76
Project tigm

Sequence tag IST12010G2HMF2
Sequence
TTTGCAAGTATAACCAGAGTATTATTAATAGTGTTAGGGATTACTGCTTGACCATGGGATGGATCTCAAACTGGGCCAGT
TATTGGTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110294152..110294239 88
NO GENE  


Sequence tag IST12010G2BBF1
Sequence
AGGGTAGGGTGTTAGTGAGCCTGCATAAGTGCTTCTCCTGAGGTTGAGCCTCTGACCCACGTCACAGTAACATTCTTTCT
TGAGAAAATCTTGCTGCCTCTTTTCTGGCGGTCTCCACCTGCTTTACTAAGTGGGAAACACCTTTAGGCCAGCACTCTCC
AAGTCGGACCTACAACAAGGTCCAATTGCTAAGGAAAGAACGTAGCCGCACGTCTGCCTGTGCTTCAACCTCCCTCTTAC
AAGTCCTACGCCATGTCACTTTCAGTCATGCCCATCCCACATCAGCTGTGTAGCATGCNCGTANCTGATGGGTGCCCAAN
ANGGCANNGTTGCCGTCCTTTCTTACTGGAAGGGCGGTGGANANGGCTGCTTTGANCTGTGACTCGCCTTCTTTGTGTTG
AGATTTTGTTTATCCTTTTCTCCNTTTGTTTCCNTTCCCCGTGTGCTGACTTTCATTTTGATTTTAN
Sequence Type genomic DNA
Unitrap ID UNI32177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104166042..104166507 444
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es