Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12148B5
Clone ID IST12148B5
Vector VICTR76
Project tigm

Sequence tag IST12148B5HMF1
Sequence
AGAAAAGTGTGGGTTNAAGAGGTCATTTTGAGGTGAGGGAAATTTCCATTCCCAAGAATGTGATGGGTGTAATAAGCTGT
ATTTGATGAGGAGCTATTTTGAATTCTAGAGAGGATAGGGAACTTATTAACTGATCTTTAAAGTTGGGAGGGGAAGGTGG
GTCCTTACTGAGTCCTTAGTCTAAGTAAGGTTTAAATGTAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI35416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 72477832..72478035 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031196 (F8) NM_007977 coagulation factor VIII Gene [Source:MGI (curated);Acc:F8-001]

 
Come back to gene ENSMUSG00000031196


For any suggestions or comments, please send an email to unitrap@crg.es