Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11745B8
Clone ID IST11745B8
Vector VICTR76
Project tigm

Sequence tag IST11745B8HMF1
Sequence
ATGGTGGTTCACAACNATCTGTAATGAGATCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCCACAGTGTACTCATGTA
AATAAAATACATAAAAATTCTAAAAAAAGCCGGGCAGTGTTGGAGCATGCTTTATTTCCAGCACTTGGGAGGCAGAGGCA
GGCAGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGACAGGGCTATACAGAGAAACCCTGTC
TCGAAAAACCAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7797898..7798163 264
NO GENE  


Sequence tag IST11745B8BBF1
Sequence
ATGGTGGTTCACAACCATCTGTAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31801 UNI35417

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4951404..4951436 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 36057799..36057831 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35225914..35225946 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32029944..32029976 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79151480..79151512 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24875333..24875365 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3641652..3641684 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071454 (Dtnb) NM_007886 dystrobrevin, beta Gene [Source:MGI Symbol;Acc:MGI:1203728]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3886546..3886578 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049721 (Gal3st1) NM_016922 galactose-3-O-sulfotransferase 1 Gene [Source:MGI (curated);Acc:Gal3st1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 74775806..74775838 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 31881353..31881385 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 13670952..13670984 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 35821439..35821471 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 134825615..134825647 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 24835752..24835784 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30391173..30391205 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 71814232..71814264 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 130965087..130965119 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7797898..7797930 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3397136..3397168 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16361533..16361565 33
NO GENE  

 
Come back to gene ENSMUSG00000049721


For any suggestions or comments, please send an email to unitrap@crg.es