Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0583
Clone ID AD0583
Vector pGT0lxr
Project sanger

Sequence tag AD0583
Sequence
AAATGCTGAGACAAATTTAAAGAAATAAGTTTTGCATATGAAGTATGTCNAAATCCAGAGAGGCGAGAGCTGTATGACAG
ATATGGAGAACAAGGCCTACGGGAAGGCAGCGGCGGAGGCGGTGGAATGGATGATATCTTCTCACATATTTTTGGTGGAG
GATTGTTTGGCTTTATGGGCAATCAGAGTAGAAGTCGAAATGGCAGAAGAAGAGGCGAGGACATGATGCATCCACTAAAA
GTATCTTTAGAAGACCTGTACAATGGCAAGACAACCAAACTACAACTTAGCAAGAATGTGCTCTGTAGTGCATGCAGTGG
CCAAGGTGGGAAGTCTGGAGCTGTTCAGAAATGCAGCGCTTGTCGGGGTCGAGGTGTGCGCATTATGATCAGACAGCTGG
CTCCAGGAATGGTGCAGCAGATGCAGTCCGTGTGCTCCGACTGTAATGGAGAAGGGGAGGTCATCAATGAAAAAGACCGC
TGTAAAAAATGTGAAGGGAAGAAGGTAATCAAAGAAGTCAAGATTCTGGAAGTCCATGTAGACAAAGGCATGAAACATGG
ACAGAGGATTACGTTCACTGGGGAAGCAGACCAGGCTCCAGGAGTGGAACCTGGAGATATTGTTCTTTTGCTACAGGAAA
AAGAACATGAG
Sequence Type mRNA
Unitrap ID UNI2396

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 88070412..88658271 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031701 (Dnaja2) NM_019794 DnaJ (Hsp40) homolog, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:1931882]

 
Come back to gene ENSMUSG00000031701


For any suggestions or comments, please send an email to unitrap@crg.es