Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10023E3
Clone ID IST10023E3
Vector VICTR75
Project tigm

Sequence tag IST10023E3BBF1
Sequence
TTTGTATGTTTTTTCCTCTTTTTCTGTAAGGACTTCTACCTGTTTGATTGTGTTTTCCTGTTTTTCTTTAAGGACTTGTA
ACTCTTTAGCAGTGTTCTCCTGTATTTCTTTAAGTGATTTATTAAAGTCCTTCTTGATGTCCTCTACCATCATCATGAGA
TATGCTTTTAAATCTAGGTCTAGGTTCTCAGGTGTGTTGGGGTTCCCTGGACTGGGCGAAGTGGGTGTGCTGGGTTCTGG
TGATGGTGAGTGGTCTTGGTTCCTGTTAGTAAGATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAG
TTATAGTTGACTCTGTTTAGAGATTGTTCTTCTGGTGATTCTGTTACCGTCTATCAGCAGACCTGGGAGACAGATTCTCT
CCTCTGAGTTTCAGTGCTCAGAGCACTCTCTGCTGGCAAGCTCTCTTACAGGGAAGGTGCGCAGATATCTTGTATTTGGA
CCTCCTCCTGGCCGAAGAAGAAAGCCCAAAACAGGACCTTTCTCAGACACTGTGTTGCT
Sequence Type genomic DNA
Unitrap ID UNI15225 UNI30676 UNI30809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48126..48664 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12577843..12578381 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3031788..3032326 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13282305..13282843 537
 
EST/CDNA Est Name
  CB249887.1 - CB527288.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11860650..11861188 537
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000065979 (C530044N13Rik) NM_146067 RIKEN cDNA C530044N13 gene Gene [Source:MGI Symbol;Acc:MGI:2443300]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5217762..5218300 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3110224..3110762 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9634079..9634617 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826141..7826679 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4770845..4771383 537
 
EST/CDNA Est Name
  CJ059242.1 - CJ058870.1 - BU057566.1 - CJ063968.1 - BB646710.1 - CF535151.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3288389..3288927 537
 
EST/CDNA Est Name
  BF458004.1 - CD806182.1 - DV060827.1 - CO433983.1 - BM963667.1 - CR520506.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255281..5255819 537
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3912549..3913087 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4232610..4233148 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110138..5110676 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3986940..3987478 537
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 13051206..13051744 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5054596..5055134 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4906040..4906578 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 9134942..9135480 537
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4551158..4551696 537
NO GENE  

 
Come back to gene ENSMUSG00000040407


For any suggestions or comments, please send an email to unitrap@crg.es