Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10117B3
Clone ID IST10117B3
Vector VICTR76
Project tigm

Sequence tag IST10117B3BBR1
Sequence
TTACTGGGAACTGAATTCAGGGCTCCACATGTCCTAGGCAAGTGCTGTGAACTACATACATTACATAGCCAACCTCCCAA
GGTAACAAGTTATCCAAGTTATACTCCCTAACTCCCCAGCTTTCTGGTTTTGTTTGTTTTGTTTTGTTTGACAAGATCTC
TCTATGTATCTCTGCCTAGCCTGGGACTTCAGTCTGTAGCTCAGGCTGGCTTCAAACTCGGATTCTCTCGTCTGCCTACT
CAGTGCTGGGATTAAAGGTTTGCACATTCTTCGTTTGTTTCTGTGGGTGCACACACGTGTTCAGCGGCTTTTGTGCATGC
ACATGTGTGTGTGGAGACCAGAAGTCAGCCTTCATATTTTGAGACAGGATCTCTCCTGGGTCTGGCGCTCACCCAGGAGA
TTGAGTTGGCTGGCCTGTAAATAAGGACCCACCCGCTCTTCCTCCCCAGGTCCACATCAGGCAGTTTACTAGCCGAGCTA
TCTCCCCAACCCTAAAAATTACATCTTTAGCCTAGCTATCCTTCATGACTTCAGATCAGTCTAATTTCATCTCCTATCAT
CCTGGGTATGTCATAGGCACATTATACATAGTAAAAATAAAATTCATAATTCTTTTCCTCCCC
Sequence Type genomic DNA
Unitrap ID UNI2324

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 36573489..36574107 611
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024346 (Pfdn1) NM_026027 prefoldin 1 Gene [Source:MGI Symbol;Acc:MGI:1914449]


Sequence tag IST10117B3BBF2
Sequence
CCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTATTTACATATAATAATAAATAAATCTTAAAAAAAAAAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI22123

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 94036408..94036482 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110716052..110716126 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007080 (Pole) NM_011132 polymerase (DNA directed), epsilon Gene [Source:MGI (curated);Acc:Pole-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107699584..107699658 75
NO GENE  

 
Come back to gene ENSMUSG00000007080


For any suggestions or comments, please send an email to unitrap@crg.es