Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10722H11
Clone ID IST10722H11
Vector VICTR76
Project tigm

Sequence tag IST10722H11HMF1
Sequence
TCACAATATTAGGAAGGTTGAGAACCCTGACTTAAAGTCCACTTTCTTAGGGGTTTCTGTTAGTAAAATTTTTGGTTCTG
TTTGTAAGTGTAAACCATTTGCATAATTTGTGATCTCTTCCATTTCTTGGCTGGAGAGGTCTTATTTTTGTGTGANATAT
TTAATTTTGGTGGAACTTGGTTTCTTTGCTTACGTGTTTCTCANATTTTAAAGCNAAGAGAAGAGGCATATATTTTATTG
TGGAANAAGGCTTTTCACACTANTAATTATATGAGGCAGAGGTGAGCCTTANTTACTCANCATTTGGTTNNATTTGGCTT
TTTGTTTTTGTTTTTGTTTTTTTGAGGCAGGATCTTACTATGTGGCCCTGGCTGCCTCTGCCTNTGCTGGGATCACAGGT
ATAGGCCACGATGCCNGCCTCAGTGTTTGTGTTGTATGGATTCCTANGAAAACCTCANAAGAAAGAGGANCCTCTTTACT
GTAGTTTGTTTTTTTNNAAATTNCTGNNATTTN
Sequence Type genomic DNA
Unitrap ID UNI30161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37287942..37288453 474
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050714 (Zbtb26) NM_199025 zinc finger and BTB domain containing 26 Gene [Source:MGI (curated);Acc:Zbtb26-001]

 
Come back to gene ENSMUSG00000050714


For any suggestions or comments, please send an email to unitrap@crg.es