Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1332-1
Clone ID PST1332-1
Vector U3NeoSV1
Project escells

Sequence tag PST1332-1
Sequence
TCATCAGAAGGCGGGGTCCGGTGTCCGGATTTGTGTCCTTACCTATTTCTGTGCTTGGTGGGTATGGCGNGCTCCCGGTC
CTGTGAGTCCAGAGGCGCCTTTTGATCCGTCCAAGCCCCCAGTTATCGAGGGCTTCAGCCCCACGGTCTACTCCAACCCA
GAGGGCTTTAAGGAAAAGTTTATTCGCAAGACCCGTGAGAACCCAATGGTGCCTATAGGTAAGTGTGTGCTGTAGGAACG
NAAGACCGAGAGGACAGCGGTTTCGTAGGGAAAGGAAATAGGGGTGGATCAAGTAAGCCTGGGGTTTGGGAAGGGGAGCG
GACCAGAGGTGTGACGAAATGACGGTGCGGGGTGGGGGGTGACTGAAACGAATCGGAATGCAATGCGGGGCTTGGGACTA
GATGAAGCAGACTGTAT
Sequence Type genomic DNA
Unitrap ID UNI15028

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54691566..54691978 400
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025868 (Higd2a) NM_025933 HIG1 domain family, member 2A Gene [Source:MGI Symbol;Acc:MGI:1914294]

 
Come back to gene ENSMUSG00000025868


For any suggestions or comments, please send an email to unitrap@crg.es