Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14425H11
Clone ID IST14425H11
Vector VICTR74
Project tigm

Sequence tag IST14425H11HMR1
Sequence
NTTCTTGTGCGTGAAGACAGGGTTGGGTGTCTCCGTGGGCACGGTGGGTCTTCCTTTCCTGGCTGGTGGCTGAGTGGCAG
CGGATGCTCTTACATAATCANTCTCTCTCTCCTCCTTCTTTTTCCAGAGCTAGACTTCACGCTGANCANCTGCAGCCGAA
NAAACCANAGAAAGCGCCACCCAGCCCCANATTCNNANAGGCCTGCCTGCTGGGGACTCCCTTCTCTTCTTCCTCCTCCT
CCTCTTCCTCCTCCTGAGACCCTCAAAGTCACTGTCTCACACNANTTCCTGAGCTGCAATGGGACTGGCAGCCACTGCCC
CCTGGCTGTCCTCCGCCCTGCCAAGCANATAGGGCGGTANCTACCCCAGGAGTATCTGCCCCCTCTCANCCTGGN
Sequence Type genomic DNA
Unitrap ID UNI14978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113279284..113279676 365
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031750 (Il34) NP_001128572 interleukin 34 Gene [Source:MGI Symbol;Acc:MGI:1923777]

 
Come back to gene ENSMUSG00000031750


For any suggestions or comments, please send an email to unitrap@crg.es