Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11965C6
Clone ID IST11965C6
Vector VICTR76
Project tigm

Sequence tag IST11965C6BBF1
Sequence
TTCTAAGGGAGTCCAAAGCTAGATACAGACTTGCAAACAGCATAAAGAAAGTTAGCANGGNNNCNNNAAAGGACNNAGAG
CACTAAACTGTTCGTTCATTACTAGATAATAAAGTCTATCTCTANACAGGGAAAATTTTAAATCTTATATTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11965C6HMF1
Sequence
TTCTAAGGGAGTCCAAAGCTAGATACAGACTTGCAAACAGCATAAAGAAAGTTAGCATGGA
Sequence Type genomic DNA
Unitrap ID UNI9690

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114390596..114390653 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031953 (Tmem170) NM_025781 transmembrane protein 170 Gene [Source:MGI Symbol;Acc:MGI:106426]

 
Come back to gene ENSMUSG00000031953


For any suggestions or comments, please send an email to unitrap@crg.es