Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1211-NR
Clone ID PST1211-NR
Vector U3NeoSV1
Project escells

Sequence tag PST1211-NR
Sequence
GTTTTAACTTGGTTTTTCTCTTGGGGTGGAGATTGAGGCTCATGCATGGTAGCCAAACCCCTGCATCCCATCCCTGTGAG
AGACTGCCTATTTAGGAGAATCTGAAAAAGCATAATTCTTTAGTTATTGAAAAAAATTGAACAGCTTTTAAAACGGGCAA
AGACTGGTTTGGGCAGTTTGTGACTTGGTTTTTGGCGTCTCAGAACTCACTGTGTAGACCTACTCAAGAGATCTTCCCTA
GTGCTGGGATTAAAGGCGTGCACCACAGCACCTGGCTGGCTTTTGTCTGTTTGTTCATTGNTTTGNTTTTTTCTTGACCT
AACAGTANTAACCATGAGGCCTGCCAGCAGAGTGAGACTCCTAACTTGAGCTATTCTCATAC
Sequence Type genomic DNA
Unitrap ID UNI86

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 128062615..128062996 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025362 (AC117232.3) NM_013765 40S ribosomal protein S26 [Source:UniProtKB/Swiss-Prot;Acc:P62855]

 
Come back to gene ENSMUSG00000025362


For any suggestions or comments, please send an email to unitrap@crg.es