Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15016F2
Clone ID IST15016F2
Vector VICTR78
Project tigm

Sequence tag IST15016F2BBF1
Sequence
TTCTTAAGGGGGCCAGCAAAACACTAACCACTCCATGTGTCATCAAGAATTATCCATAGCAACCGTCAAACATAGACCTA
AAGGTGCTTAGGGGATCTCTGAATTAAAAATTACGAAGGTTGGTGTGGTGGCTCAAACTTTCCACATAATACTAGTACGC
CANGNNGTAAAGGCNGGAGGANNNTGCCCANCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15016F2HMR1
Sequence
AAGAACAAGTGATAATAAGCAGCAAGGACCTCTANAATGCTCCTTTACTCTTGGTTTTTTGAGACAGGGTTTCTGTCAGT
CACTGCCTGGCTCCTTTATTCTTGCTGGGCATCTAATATCACTTTTCTTTCCCCATACCATTGCTAGCCCCAGTGTTCAC
ATAATCTGTAACTCCCGACTAGGTGGAGAAATGGAACCGACGTGATCAGAAGCTGCTGGAGGCGGTGCAGCGGGGGGACG
TGGGACGCGTGGCTGCCTTGGCCTCTANGAAGTCAGCCCGACCCACCAAACTAGACTCAAATGGCCN
Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96481874..96482179 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es