Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST811-1
Clone ID PST811-1
Vector U3NeoSV1
Project escells

Sequence tag PST811-1
Sequence
GAATTCACAAGCCTCAGTCAGTGGCTCTAGTTCCAGTTTATGAATGAATCACCTTAACCAGAAGAGGGAACCGTTAAGTG
TGTGTCTCTCAGGGCACAGCGGTGAACTGTAAGAGAGAGTAGGCCAGGCCGAGGCTGTATACATTTCTGTCTGTCACTTA
ACTCTGGACTCCATTGACCTCAGACTTCATGCGGGATAATCTGTGATATGCCTGAGCTCTAGGGGGTTTCGTTTCATGGT
GGTGGCCTGCAGTGCTGGAGAGTCGGCCCGCAGGACCTCAGGCCTGCCAGTTAGATGTCTGTCCACTGAGTCACACCCCC
AGCTCAGCACACTATGCACGGTTGCTACAACCTGGTGTAGGGAGAGCAGTCCTGATGAGTCTGGGAGTAGGA
Sequence Type genomic DNA
Unitrap ID UNI14730

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106527873..106528264 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es