Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10770H2
Clone ID IST10770H2
Vector VICTR76
Project tigm

Sequence tag IST10770H2BBF1
Sequence
CATTATGCATGGTTTTTGAGTGTTTGTTTGTTTGTTTGTTTGTTTTATTTATTGGTCTTTCTTTCTTTCTTTTTTAAAAN
ATTTATTTATTATTATATCTAAGTACTCTGTAGCTGTCTTCAGATGCACCANAAGAGGGCATCANATCTG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168603496..168603644 143
NO GENE  


Sequence tag IST10770H2HMF2
Sequence
ACACAACAGTTTCATATTTAAAAGCCTGGGCACTGATTGTTTCAGTTTCAAGTGTAGCCCCATCTGTCATGTGTGTTAAT
CATCCACAGAGCTGTTTGCTTTGAGTGGA

Sequence Type genomic DNA
Unitrap ID UNI15588

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41658731..41658838 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]

 
Come back to gene ENSMUSG00000039431


For any suggestions or comments, please send an email to unitrap@crg.es