Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0552
Clone ID AD0552
Vector pGT0lxr
Project sanger

Sequence tag AD0552
Sequence
AAAAAGGCCAGAATGGCCGTGGCGAGGGCCGTGCTTGAAAAGGGTACGATGATGCTCCTCACAGCCTCAAAGACATGTCT
CAGGCATCCCAGCTGTGAGTCAGCCCACACAAACAAAGAAGGAGTGTTTGACCGGATGAGAGTGGCCCTGGAGAAGGTCA
CGGAGATCGTGACTGACTGCAGACTCAGCGGAGAGACCGACAGCTCATCTGTCAGCATTTTTACTGGGATTAAAGAGTTG
AAGGTGAATATTGAAGCTCTTCGGGAGAATGTTTGCTTTGAGTCCAAAGAGAACCTTTCTGCCGCATTGGAGGCCGTCTT
GGAGCATGTGGAGGACTTCACTGATTCTGCCTACACCAGCCACGAGCACAGGGAACGGATCTTGGAGCTGTCTTCTCAGG
CGAGGACAGAGCTGCAGCAGCTCCTTTCCGTGTGGATGCAAACCCAAAGCAGGAAGACAAAGAGCGCCGCCGAGGAGCTG
GAACTCACAGTTCTGAAGATCAGCCACAGCCTGGACGAGCTGAGGAGAGAA
Sequence Type mRNA
Unitrap ID UNI2911

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56845778..56851909 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es