Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14981A7
Clone ID IST14981A7
Vector VICTR76
Project tigm

Sequence tag IST14981A7HMF1
Sequence
ATTATAACTGTTGTGTGACTCCGCCGTGAGTCTCCTGTTGTGCCCGTTTGTAGCACTGTGGTTTTATGTGGTGTTGTATT
TAAGGGTTCTATAAATGTGGTTGTGATTTCATCCTCAGGATGGATGTGTGACTGTGACTATCCAACCATACATTGTTGTG
CTGTCATTTGGGTANGGTGTGCTTGTGANGATATATGTGGTTCCATGGTGGGNGACTGACNNCANCTGTGGGTNNGTN
Sequence Type genomic DNA
Unitrap ID UNI15003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30694741..30694973 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058402 (Zfp420) zinc finger protein 420 Gene [Source:MGI (curated);Acc:Zfp420-001]


Sequence tag IST14981A7BBF1
Sequence
ATTATAACTGTTGTGTGACTCCGCCGTGAGTCTCCTGTTGTGCCCGTTTGTAGCACTGTGGTTTTATGTGGTGTTGTATT
TAAGGGTTCTATAAATGTGGTTGTGATTTCATCCTCAGGATGGATGTGTGACTGTGACTATCCAACCATACATTGTTGTG
CTGTCATTTGGGTAGGGTGTGCTTGTGAGGATATATGTGGTTCCATGGTGGGTGACTGACAGCAGCTGTGGGTTTGTAGA
TTTGGTGTGCCTCTGACTGCCCAAGTGACTCCAATTTTCTGTCCTAANANACCCCCAGTGAGATAANAACAGATTCCAGT
ATTGGACAACATAGGCTACATTCCTTCTCTGACTCTANACATTATCNTGANAACCTAGACTTCTCCCTGGGTGACAGGTA
TGGATCN
Sequence Type genomic DNA
Unitrap ID UNI15003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30694741..30695146 394
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058402 (Zfp420) zinc finger protein 420 Gene [Source:MGI (curated);Acc:Zfp420-001]

 
Come back to gene ENSMUSG00000058402


For any suggestions or comments, please send an email to unitrap@crg.es