Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10973F7
Clone ID IST10973F7
Vector VICTR76
Project tigm

Sequence tag IST10973F7HMF1
Sequence
TTTGTTTGTTTGTTTATTTGTTTGATTGAGCCAGATTTTCTCTGTGCAGCTCTGGCTGTCCTGAAACTTACTCTGTAGAC
CGGACTGCCCTTAAACTCACAGAGATCCAGCTGCCTATGGTTCCCAAGTGCTGGGGGTTAAAGGCCTGTGCCACCACCAC
CTGGCTGAAGAAAGTCTTAAGGCTTTGTGGGCTCCATTGTGGATGGCATCGCCCCCTAAGGAGGGCCCNTGANTCAAATA
ATANTGGAAAGATAAAGCTGATCATATGCTANCAAGCAGGAAGCACGCATGCGCGTGTGTCTCGTCACTCTTGGCTGTGG
ATGTGACGGGACTGGCTGCTCTGANCTTCTGCTGCTGTGACTTTCCTGCTGTGGTGAGCTGTATGAACAGTGAGTAGAAA
TGAGCCCCTCTTCCCCCAGGTTGTTTTATCAGGGTATTTTATCACTGCANCAGAAATGAAACCNGGACAGAGGNTATNAT
ACCTTTGCTATCTTNNGGGTGTGGNNTCAACTGCTAGCATNCTCTTTNACTCCTTANCAN

Sequence Type genomic DNA
Unitrap ID UNI35424

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53923215..53923753 507
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079504 (AC084054.12-202)  

 
Come back to gene ENSMUSG00000079504


For any suggestions or comments, please send an email to unitrap@crg.es