Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14644H4
Clone ID IST14644H4
Vector VICTR74
Project tigm

Sequence tag IST14644H4HMR1
Sequence
NTGCTTTCTTGCTTCTCTCTCTCTCTCTCTCTCTCTCTN
Sequence Type genomic DNA
Unitrap ID UNI31027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17217045..17217081 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067034 (Zfp97) NP_001005358 zinc finger protein 97 Gene [Source:MGI Symbol;Acc:MGI:105921]


Sequence tag IST14644H4HMF1
Sequence
GCAGGACATAGACATAGAGGTCTCTCAGAATAGCAATCAAGCAGAATATAGACAAGGAAATCTCCAGAGAGAGACAGAGC
AGCACAGAAATATTAGCAGAAGGAAAATCCATATCCAGAAAAATAAATGTCATCCACTTTGAATCTATGCTTTTTCTTTT
CACCACTGCCAGACACCTCTTCTCTCAGATCCTCTCTGAAGCTGAGCCTGGTCTATTGCCACATATGAACACATACCTGT
AACATATACCATATAACCCACATGAGACCCCAGGCTTTCTGAGCCACAGGAATACCACCCTATCTTCCACACTATTCCCA
CTTCTACACTCACTCTCACTGCAAATTTACCCCCTCAAATCTTCCAAGGCTTTCCTCAAGTTTTGCCATTTTTGTATCCN
AAAGAGACAGCCTGAGAAACATGTATATACATATCTTTTTGCAGTCACAGNGCAGTCTTATTNNGTGGTTTTGCAGTGTC
CTTGGTAATACTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17216555..17217047 485
 
EST/CDNA Est Name
  BY196900.1

 
Come back to gene BY196900.1


For any suggestions or comments, please send an email to unitrap@crg.es