Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14678C8
Clone ID IST14678C8
Vector VICTR74
Project tigm

Sequence tag IST14678C8HMR1
Sequence
TTACATGGGTCTTTCCCGGTTCGGTTTAACCCAGGCTTTCTGTGGCAGATANGCTTGCACAAAGCTGCCNGTTCCCCAAT
TCTTACCTGCTCTTCANGTGANCNGAGGTGCTGGGCTGGACGTGGACTTCACCTTGGAGAGCCCTCAGGGTGTGCTGTTG
GTCAGTGAGTCTCGAAAGGCTGATGGGGTACACACGTGANTGAANTCCTGCCCTGCCTTGGTTCNNNTACNGCCCTGCAG
CTCCCCAGTGGCCTCAGGTTACCATCCTACTGGTTCNNCNGN
Sequence Type genomic DNA
Unitrap ID UNI35426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21313617..21313892 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032180 (Tmed1) NM_010744 transmembrane emp24 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:106201]


Sequence tag IST14678C8HMF1
Sequence
AGATCACCAAGAACCTATCTTTAAGAAGAAAAAAGAACAACCACAAATCCCAGGTATTTGCTTGAGATAGAGGAGTAGCG
CCTGTGGAGGGAGATTAGTCAGAGCTGCACTTCTACCATAGAGTTAGGAAACTCGGGTCGTCGTAGTTTAGCAGCAAGCG
GTTTTTGTTTTGTTTTGTTTTGTTTTAACCCAGCAAGCTATTTGGATTCCCCCAAGGGCCTATCTGAAGACCAACATCCA
TCCACACCTACAAGGTTTCTTCCCAGTCCCTAAGATGGATACATCCACGTGAGGTCTTTTATCAACCACCCTGCCAACGC
CCTTGAGTAGTCTAAGGTGGCTGTCTACCTGACCGCTAACTTAATCGTAACCTACCCAACAGCCGCCAGGAACTTCCCTA
GAACCCAACCCAAAGAGCTCTGANCANAGCATGCNCCTTCTCTGCNAGANTATTANCGTTNTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21313892..21314358 453
 
EST/CDNA Est Name
  CB203970.1 - CJ043622.1 - BY734425.1 - CB195572.1 - CX221677.1 - CF906088.1 - CJ048016.1 - CX200928.1 - BG087348.2 - BM460820.1 - BQ925488.1 - BY032837.1 - CX201898.1 - BI154045.1 - AA646401.1 - AA286593.1 - AA200905.1 - AW762889.1 - BB853597.1 - CJ178457

 
Come back to gene CB203970.1 - CJ043622.1 - BY734425.1 - CB195572.1 - CX221677.1 - CF906088.1 - CJ048016.1 - CX200928.1 - BG087348.2 - BM460820.1 - BQ925488.1 - BY032837.1 - CX201898.1 - BI154045.1 - AA646401.1 - AA286593.1 - AA200905.1 - AW762889.1 - BB853597.1 - CJ178457


For any suggestions or comments, please send an email to unitrap@crg.es