Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0536
Clone ID AD0536
Vector pGT0lxr
Project sanger

Sequence tag AD0536
Sequence
ACCACTACCGGGCTCCTGTCCATACTCTCTCTGGCTTCCCATACGCGTAACGCAGAATTTCGAATGTGGCGGCGGTAGCT
GCGGAGCGCGGCGGAGCGGGAGCTTGCATCTGCTGGTCCGGACCTGAGTGGCCGAGATGAATTTCACTATGTAGCCCAAG
CTTAAATCTATGACCCACCTGCCTTAGCCTTTTAGTAGCTTGGATTATTCTACAACACCTGACTTAATATTTCTAAGCTG
AAAATCAAAATTATTGCTTTTTTTGAAACAAAGATGGCTAAGGAAAGGTGTCAGAAAAGGTCCTTTCAAGATACCCTTGA
AGACATTAAGAATCGAATGAAAGAAAAAAGGAATAAAAATTTGGCGGGGATTGGGAAACGCAAGTCCTTTATTGTTGCAC
CGAGCCAAATACCCACTAACACTGCTACACTACTGAGATATTACCAAGATAACAACAGGTTGTTAGTCTTGGCTTTGGAA
AATGAGAAATCCAAAGTGAGAGAAGCACAGGATGTCATCCTGCAACTGAGAAAAGAATGCTACTACCTTACTTGTCAGCT
GTATGCATTGAAAGAGAAGCTAACTTCCCGACAAAGTGAAGAAACGACTCAG
Sequence Type mRNA
Unitrap ID UNI2913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53826409..53828631 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023940 (Sgol1) NM_028232 shugoshin-like 1 (S. pombe) Gene [Source:MGI (curated);Acc:Sgol1-001]

 
Come back to gene ENSMUSG00000023940


For any suggestions or comments, please send an email to unitrap@crg.es