Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15088C5
Clone ID IST15088C5
Vector VICTR80
Project tigm

Sequence tag IST15088C5BBF1
Sequence
ACTTCTTGGATCTCTCCCTCTTGCTTACCCAATACAAGAAACAGAAGAGACTACAGTGAGGGGTTTTGAACCAAAGGTGG
ACAAGGAAACAGCAAGCTGAACAGAAAAGGTGCTGGCCACACCTCTACCAGCTGACAGCCAAGAAGCTCCGAGATGAAAC
CAAAACTCTAGCCTCTCTGCCCTCGGCTTTAAACCAAAGTCCAAAAACACCAGTCGGGATCAAGTGCAGGATAACTGCCC
ACCCATTCCCTGAATCCACGCTGGAACTGAACCTGCCCAGGATCGCAGGATCACCATGGCAACCATCAGCTCTAAAAGTT
CAACGCTGTCACTTTTCAAAAGATTCTTCCATTTTAAGATTGAATTGCGAGCGGGAGAGGAGTATGAATAACATTTCCTT
TTCTACCAATTGTCTAGGATTTTAATGCNACTAGACTTCTATCTGTAAGANAAAAAGTCTANGAAAACTTTTCTAANTCT
CTATTTCTAAGANAAAAATATTACAGTTACNANAAAAAGAGGANGGGTACTAAACNTGNTGTCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129652467..129653010 524
 
EST/CDNA Est Name
  AV069303.1 - AI390866.1


Sequence tag IST15088C5HMR1
Sequence
AAGTGTGTGGGAGGCTGGTCCTGTATGAACTGAAGTCCCCGCTGTGCCTGGTGCTGACAGTTCAGGGGGTGGCACCAAGT
TCTCTCCTGGCCCGCTGCCTCTGTCTTGTGGCCTTCAGCTCTTCATCTGAGTGTGGGCACTGGCAGCAGCTGTGGGCCTG
TCAGAGCTGGTTATCCATTTATCAGAGTCTTAGAGGAGGATGTGAATTTTATGTGCATTAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI20252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129653007..129653239 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025812 (Pard3) NM_033620 par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]


Sequence tag IST15088C5HMF1
Sequence
ACTTCTTGGATCTCTCCCTCTTGCTTACCCAATACAAGAAACAGAAGAGACTACAGTGAGGGGTTTTGAACCAAAGGTGG
ACAAGGAAACAGCAAGCTGAACAGAAAAGGTGCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129652895..129653010 116
NO GENE  

 
Come back to gene ENSMUSG00000025812


For any suggestions or comments, please send an email to unitrap@crg.es