Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14348E4
Clone ID IST14348E4
Vector VICTR74
Project tigm

Sequence tag IST14348E4HMF1
Sequence
AGGTTTGCCCTGATCTCTAACCATCATGGTTTTGTGCCTGTAGTGGACCCACATGGAGGCTCACCCCTGGCTAGTCCCAT
GTCCCCTCGATCTCTCTCCTCCAATCCATCCTCACGGGACTCTTCGCCTAGCCGAGACTACTCACCAGCTGTCAGTGGAC
TCCGTTCCCCCATCACCATCCAACGCTCAGGCAAGAAATATGGGTTCACACTGCGAGCCATCCGTGTCTACATGGGCGAC
TCCGATGTCTACAGTGTCCACCACATTGTTTGGGTGAGTCTCATAGGCTCATAGTCTCNTAGCAGTTACAAAGCCAAAAT
GGCCCGAAGATACAAAAGGTCTCCGGCTAAAGATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI31331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87439969..87440327 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]


Sequence tag IST14348E4HMR1
Sequence
NCTNACACTCTGCTCCTCTATCCTAAAACCCCAGANCGGGTTCTTCATTACTCCACCCTGAGGCCAAACAACCTTCCTGC
CACAATTGCAGGGAGCCCCTTCCCTGGTGTGTGGTGCCCCACTTCACCTGCAGGAATCATGACTGACAAGGCTGTANCTG
AAGCCGACTTGATAACTTTGCCCCCAGTTCGAGACGGTCGCTTCTCCACAGCAAGATCCCCANACAGCTGCTGGTGCCTT
GCCCTTCGCAAAACCAGGTCGTTGGTGGCCCTAGGGCCNGANGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87440326..87440608 271
 
EST/CDNA Est Name
  CJ186261.1 - CJ182343.1 - CJ181195.1 - CJ185048.1 - CX562525.1 - CA749141.1 - BM951506.1


Sequence tag IST14348E4BBF1
Sequence
AGGTTTGCCCTGATCTCTAACCATCATGGTTTTGTGCCTGTAGTGGACCCACATGGAGGCTCACCCCTGGCTAGTCCCAT
GTCCCCTCGATCTCTCTCCTCCAATCCATCCTCACGGGACTCTTCGCCTAGCCGAGACTACTCACCAGCTGTCAGTGGAC
TCCGTTCCCCCATCACCATCCAACGCTCAGGCAAGAAATATGGGTTCACACTGCGAGCCATCCGTGTCTACATGGGCGAC
TCCGATGTCTACAGTGTCCACCACATTGTTTGGGTGAGTCTCATAGGCTCATAGTCTCATAGCAGTTACAAAGCCNAAAT
GGCCCGAAGATACAAAAGGTCTCCNGCTANNGATGGCCNANANAGGTGGGTANGGCCATAANTNGCTTCTTCTACCN
Sequence Type genomic DNA
Unitrap ID UNI31331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87439932..87440327 376
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]

 
Come back to gene ENSMUSG00000053693


For any suggestions or comments, please send an email to unitrap@crg.es