Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12256A8
Clone ID IST12256A8
Vector VICTR76
Project tigm

Sequence tag IST12256A8HMF2
Sequence
AGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCTGCCAGC
CTCTGCCTCCGGAGTGCTGGAATTAAAGGCGTGTGCCACCACCACACCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154248859..154248989 131
NO GENE  


Sequence tag IST12256A8BBF1
Sequence
AGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGANCTG
Sequence Type genomic DNA
Unitrap ID UNI23647 UNI35431 UNI35432 UNI35433 UNI35434 UNI35435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45004598..45004634 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24208894..24208930 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 92354968..92355004 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 28415150..28415186 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54624958..54624994 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63465655..63465691 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037257 (2310007F21Rik) NM_025857 RIKEN cDNA 2310007F21 gene Gene [Source:MGI Symbol;Acc:MGI:1914189]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18442789..18442825 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019852 (D10Bwg1379e) NM_001033258 Brefeldin A-inhibited guanine nucleotide-exchange protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q3UGY8]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11636198..11636234 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 125140548..125140584 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038252 (Ncapd2) NM_146171 non-SMC condensin I complex, subunit D2 Gene [Source:MGI Symbol;Acc:MGI:1915548]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107220186..107220222 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3956524..3956560 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 99337674..99337710 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 29156099..29156135 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063600 (6130401L20Rik) RIKEN cDNA 6130401L20 gene Gene [Source:MGI Symbol;Acc:MGI:1922990]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22575198..22575234 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 160655584..160655620 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035877 (Zhx3) NM_177263 zinc fingers and homeoboxes 3 Gene [Source:MGI (curated);Acc:Zhx3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 67616839..67616875 35
NO GENE  

 
Come back to gene ENSMUSG00000035877


For any suggestions or comments, please send an email to unitrap@crg.es