Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10950E9
Clone ID IST10950E9
Vector VICTR76
Project tigm

Sequence tag IST10950E9HMR1
Sequence
TGTCCTTCTTACCTGTTGGGGCATCTTCTGGATATATGCCCAGGAGAGGTATTGCTGGATCCTCCGGTAGTACTATGTCC
AGTTTTCTGAGGAACCGCCAGACTGATTTCCAGAGTGGTTGTACGAGCCTGCACTCCCACCAACAATGGAGGAGTGTTCC
TCTTTCTCCACATCCTCGCNNNCNTCTGCTGTCACCTGANTTTTTGANCNTANCCNTTCTGACTGGTGN
Sequence Type genomic DNA
Unitrap ID UNI32606

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 47986831..47987058 210
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 88614581..88614808 210
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 37362690..37362917 210
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 51737296..51737523 210
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173788958..173789185 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038147 (Cd84) NM_013489 CD84 antigen Gene [Source:MGI Symbol;Acc:MGI:1336885]

 
Come back to gene ENSMUSG00000038147


For any suggestions or comments, please send an email to unitrap@crg.es