Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0455
Clone ID AD0455
Vector pGT0lxr
Project sanger

Sequence tag AD0455
Sequence
CGGCGGGTGTGAGAGTCGGTGTTGTGAGCCGCTTCCAGGATCCTGCGATCCGGAGAAGCCGGGGTCTGAGCGGCTCCTCC
AGAGTTCCTGATCTATGAAATGGCAGAGAATGGAAAAAATTGTGACCAGAGACGCATAGCAATGAGTAAGGATCAGCACA
ATGGAAGTCTCACAGACCCCTCTTCAGTTCATGAGAAGAAGAGAAGGGATCGGGAAGAAAGACAGAATATTGTCCTGTGG
AGACAGCCACTCATTACCTTGCAGTATTTCTCTCTGGAAACTCTTGTAGTTTTGAAGGAATGGACCTCAAAATTGTGGCA
TCGTCAAAGCATTGTGGTGTCCTTTTTACTGCTGCTTGCTGCGCTTGTAGCTACGTATTATGTGGAAGGAGCGCACCAAC
AGTATGTGCAGCGGATAGAGAAGCAGTTTCTTTTGTATGCATACTGGATAGGCCTGGGGATTTTGTCCTCTGTTGGTCTT
GGAACAGGACTGCACACCTTTCTGCTTTATCTG
Sequence Type mRNA
Unitrap ID UNI2915

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86474625..86497314 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018171 (Tmem49) NM_029478 transmembrane protein 49 Gene [Source:MGI (curated);Acc:Tmem49-001]

 
Come back to gene ENSMUSG00000018171


For any suggestions or comments, please send an email to unitrap@crg.es