Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12817A7
Clone ID IST12817A7
Vector VICTR76
Project tigm

Sequence tag IST12817A7HMR1
Sequence
CTGGTGGCAGGCAAGGGACCTGGGGGGACCTGGCCTGTGCTGCACAGTGGCAGGAGGAACANGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73015332..73015392 61
NO GENE  


Sequence tag IST12817A7HMF1
Sequence
ACCTTGCACCCCAGTTGCAGCTGTACACCTCCAAACCTCTTTCTTCATTCTCATGCTTCCCCCGGGCTTCCTTATATTAC
CCTGGTCAGCCTAGAGTGGACCTCATCTTATCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI25917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73015420..73015535 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030513 (Pcsk6) proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]


Sequence tag IST12817A7BBF1
Sequence
NAANAAACAGGGACNAGGCTCTTTCCAGAGGTANAGCGAGGTAATCTAATTTCCATTTTTAAAGAGTAACCAGATGGATG
GGCCAAATAAAGGGGAAACTTCCTGGAAACGAGCTGGGCACGGCAATGAACGGGCTGATGGGATTTTCCTGTGTGACGGC
CTGTGGCGTGGCGCATGGAGGAGAACCAGCCGCCTGGCTCTGAGCATCCAACCAGGGCTCAGGGCAGGATGGAGTCCTTT
CTCCGTGACTCTTCCNACTCAGGATTCTAAGCTTTCTAGCTGANNANNCNGGGGGGCANCTTGCCACAAATCCCCCGGCA
AGCTTATGGTTTTCTTTGTTCTGTTGGTTTCTCTCTGCCTCCCCAACCAAGCAGANCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99326586..99326963 356
 
EST/CDNA Est Name
  AA035915.1 - AI322609.1 - AA200952.1 - CA895583.1 - CJ148499.1 - CX221847.1 - CJ150003.1 - CJ149909.1 - CJ146036.1 - CJ148934.1 - CJ155524.1 - BY309786.1 - BY323181.1 - CJ162751.1 - BY008155.1 - CJ162394.1 - BY327691.1

 
Come back to gene AA035915.1 - AI322609.1 - AA200952.1 - CA895583.1 - CJ148499.1 - CX221847.1 - CJ150003.1 - CJ149909.1 - CJ146036.1 - CJ148934.1 - CJ155524.1 - BY309786.1 - BY323181.1 - CJ162751.1 - BY008155.1 - CJ162394.1 - BY327691.1


For any suggestions or comments, please send an email to unitrap@crg.es