Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14944A9
Clone ID IST14944A9
Vector VICTR76
Project tigm

Sequence tag IST14944A9BBF1
Sequence
ATGACCNTCCCCCCAACACATTCCTATTTAATCTCATCTTCACATCTGAACCCTATTCCAAGAGCCTTTGGACTCTTACC
GTGACGAANACGACATTGTTGGGGAAGACAGATGTGTCCGCTCCATCCAAGGGCACTTGGGGTGCAGCGATGGGACCCCG
GCTGGCTGTCAGTGAGGCTGGGAAGCAGCTCCTTTTTCGGACAGTGATAGTCCCTTCCTCCCCCTCTGTCCCTGGGTCCC
CCTCAGAAGTCTGAGCTTGGAGACGAAGCTCCTCCGACAGGTAGTGTCGGATATTTTGGCGAGCAGAGTGGATAAGCCGT
GGATCAATGTCCAGCCCCACCATGCGGGCTGGGCCCCACTTGCAGGCNATACTTAGGGTCAGATGGCNNACGTTGCAGCC
CANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138225610..138226016 395
 
EST/CDNA Est Name
  CB590246.1 - BF144794.1 - AA832941.1 - BG079531.2 - BU583915.1 - BE655426.1 - AL118421.1 - BI696507.1 - AA051317.1 - CK129235.1 - BY725663.1 - CB194121.1 - BG866538.1 - CF423312.1


Sequence tag IST14944A9HMR1
Sequence
GTNNTGACCTANAGGTGTATCCNTGCGTCCATCTGTTCCTCCATACAAGAACCACCTCCTGGAGAGAACAGGATT
Sequence Type genomic DNA
Unitrap ID UNI26225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138225540..138225610 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029726 (Mepce) NM_144913 methylphosphate capping enzyme Gene [Source:MGI (curated);Acc:Mepce-001]


Sequence tag IST14944A9HMF1
Sequence
ATGACCATCCCCCCAACACATTCCTATTTAATCTCATCTTCACATCTGAACCCTATTCCAAGAGCCTTTGGACTCTTACC
GTGACGAAGACGACATTGTTGGGGAAGACAGATGTGTCCGCTCCATCCAAGGGCACTTGGGGTGCAGCGATGGGACCCCG
GCTGGCTGTCAGTGAGGCTGGGAAGCAGCTCCTTTTTCGGACAGTGATAGTCCCTTCCTCCCCCTCTGTCCCTGGGTCCC
CCTCAAAAGTCTGAGCTTGGAGACGAAGCTCCTCCGACAGGTAGTGTCGGATATTTTGGCGAGCAGAGTGGATAAGCCGT
GGATCAATGTCCAGCCCCACCATGCGGGCTGGGCCCCACTTGCAGGCAATACTTAGGGTCAGATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138225610..138225995 384
 
EST/CDNA Est Name
  CB590246.1 - AA832941.1 - BU583915.1 - BE655426.1 - AL118421.1 - BI696507.1 - AA051317.1 - BG079531.2 - BY725663.1 - BG866538.1

 
Come back to gene CB590246.1 - AA832941.1 - BU583915.1 - BE655426.1 - AL118421.1 - BI696507.1 - AA051317.1 - BG079531.2 - BY725663.1 - BG866538.1


For any suggestions or comments, please send an email to unitrap@crg.es