Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11375A9
Clone ID IST11375A9
Vector VICTR76
Project tigm

Sequence tag IST11375A9BBF1
Sequence
CCTGCGTAGAAGAGAGCCTGATTAATTTGATATGATAGTGATCAAATGGTGATGTTTTCAAAGCGTGTGAGCCCTAAAGA
TGTGTATTATGTGTGGATCTAGTTGGCCGGGCATCCGGTCGGGACTGATCTGAATGTGAGCATGTTTGGGATCAATAAAG
TCCCACGTCACANAGGGAAAGAAAGGAATATANTTAGGGTAGAAAGAGACNCTGTGTANAAGAGCANAGGTGATGGTTTT
GGCGTTTTAAATTTATGCNCNNATTTGGTTTGGTATTAATTTGTAAATGTTGTAATTCTTGATGTAAGGATTACCCGCAG
GTTTTCAAATTCCGTCTCCANATCTG
Sequence Type genomic DNA
Unitrap ID UNI15829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38780007..38780351 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]


Sequence tag IST11375A9HMF1
Sequence
CCTGCGTAGAAGAGAGCCTGATTAATTTGATATGATAGTGATCAAATGGTGATGTTTTCAAAGCGTGTGAGCCCTAAANA
TGTGTATTATGTGTGGATCTAGTTGGCCGGGCATCCGGTCGGGACTGATCTGAATGTGAGCATGTTTGGGATCAATAAAG
TCCCACGTNACAAAGGGAAAGAAAGGAATATANTTANGGTANAAAGAGACNCTGTGTANAANAGCAAAGGTGATGGTTTT
GGCGTTTTAAATTTATGCNCNGATTTGGTTTGGNATTAATTTGTAAATGTTGNAATTCTTGATGTAAGGATNACCCGCAG
GTTTTCAAATTCCGTCTCCAGATCTATCGGGTATCCCTCGTANTGNATTTTTGGAAATGCCTTCCTGTTTGCTNNTNNNN
TCTGNTNCCACCTGTGCTTNACTATCANATGACANATTTTATTGCANNCNTCACTTTNNAATTCTACATGANAATATNAT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es