Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14924B5
Clone ID IST14924B5
Vector VICTR76
Project tigm

Sequence tag IST14924B5HMR1
Sequence
CNTGGGCTTGATCTGGAAAAAAAAGTTTATTATTATTGTCCCCACATTACAAAAATTTATGTAAGAACAAGATCCAGGTA
ATAAAATAAATGAACAAGTGTTTAAAGTAANCAAANATTAAAAAAAGAAAGGAAAAAAAAGCAGGGCAGGGGTGCTGTAA
CCTTTGCCAACACTGGTGGGGGGCGGGGCAAAGGCNNGTNNACTTTGANGATANCTTATTCTACATANATNNCCTGTTTC
NNCNCCCTCCCNTGACCCCCACNNAAAAANTANNCNAAANTNTNTTCCTTTCCCCATTATGTANCCTAGGCTAGGGTGAA
CTCAGAATATACCTCAGGCTGGCCTNNNNNNNNNNNCANTCTTCCTTTGTTTTTCCTANCACAGGGATCACAGGCGTANG
CCACCNTGCNTGGCTGCCTCCNTCCTTTTTGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14924B5HMF1
Sequence
ATGTAACCCAGATGGAGGGAAACATGGCAGCATCCGGGCATGCATGGCACTGGGAGCTGAGAATTCTCTATGTTGTTCTC
AAGGCAAACAGGAGAAGTCTTGCAAGCAGTGAGGAGGGTCTCATAGCCCACCCGCACAGTGCCAGTTCCTCTAACAAGGC
CACACCTACCCACAGTGCCTCGGCCCATGGGCCAAGCATACTCAAAA
Sequence Type genomic DNA
Unitrap ID UNI12824

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122460969..122461163 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]

 
Come back to gene ENSMUSG00000031826


For any suggestions or comments, please send an email to unitrap@crg.es