Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11571A3
Clone ID IST11571A3
Vector VICTR76
Project tigm

Sequence tag IST11571A3BBF1
Sequence
NCAAGAGTCTGTCTTGAAAGAAAAATAAGTAAGTAGAAACCTANNTAGCTGCCAAGTCAAATTTTCCATGGGTCANTGCA
GCCAACACCCACCCATCTGACAAATGCTACACACCTNTGCTTANCTGGACATGTCTAGCTTTNTTACTGCTTTCCAACCA
TTTTGAAATTCATGTCCTTTTTATATTTTGCTCATTTGGAACTGACCAATTATATAATTCTTANGAACTGTCTTAATTAC
TTTTTAATTGTTGTGACTAAAACACCATGACCTANNCAATTTATAAAAGAAGGCATTTATGTTGGGTATTGTGGCACACA
CCTTTAATCACTGCNCATGGGAGACAGAGCAGACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22328226..22328584 339
NO GENE  


Sequence tag IST11571A3HMR1
Sequence
TGCTATGTAGCCCATACTGGCTTGGAACTTTCAATCTTTCTGGCTGCCTGGGATCTAGGTGTGATTATAGGGGATGTCAN
AAGATCAACACTGTTTTCCCAGGTTCAAATGAAGTACCCTGCACAATGGGTGTCCTACCCTGGGTTTCAGCAAGGCTCAG
TTGCTGCANACTGGTCTCTAATCANAGGAACATATTGCTTGAANAANCCTTTGTGGGGACTCCNGGGTTGCTGGAGTCTT
CACGCCACTGAAATTATTAAGGCATGTGCCATCATGCCTGGTTTGTTTGATCTGAGGCAAGATCTNATGTNNCCNANGTT
C
Sequence Type genomic DNA
Unitrap ID UNI11806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22328583..22328902 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021767 (Myst4) MYST histone acetyltransferase monocytic leukemia 4 Gene [Source:MGI Symbol;Acc:MGI:1858746]

 
Come back to gene ENSMUSG00000021767


For any suggestions or comments, please send an email to unitrap@crg.es