Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1077-2
Clone ID PST1077-2
Vector U3NeoSV1
Project escells

Sequence tag PST1077-2
Sequence
GNTAGGTGCTTGTNTACGTTTACTAGACCTGTCTTTTATCACCAGCACTGTTAAAGAAAAANATAATCATAAAAATGCTG
AAAGTGAATGTATTANAATGTTGTTGGTGAGAGGTTATATATTTTTTTCTTCTAAAATTTCGGTGATTTATATTTTGTTT
TACTTAAAGTATAGTTTGGACCGCTTCTGTAAATGGTAGGTGGTGATAAGTTGCTGCAGACCTTACCAGCAGTGCTTGAG
TTATCCAGTGAGCTGTGTCCTCACGCTAATGTTNAAGNTCTGCCTAANNATGGAAGACCTCAACTTGCTTTTTTTGTTTT
GTACAGGGTTTCGTTGTGTAGCANTGGCTGTCTCAGAACTTGCTCTGTAGACCAGGCTGGCCTAGAACTCACAGAGGTCC
GCCTGCCTCTGTCTNANAAGTGCTGGGATTAAAGGTGTGCACCAACTG
Sequence Type genomic DNA
Unitrap ID UNI3659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109130006..109130448 413
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066306 (Numa1) NM_133947 nuclear mitotic apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443665]

 
Come back to gene ENSMUSG00000066306


For any suggestions or comments, please send an email to unitrap@crg.es