Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14664H2
Clone ID IST14664H2
Vector VICTR74
Project tigm

Sequence tag IST14664H2BBF1
Sequence
GGGTTATATGGCATTATCATCTCAGGACAACCAGAACAAACAAAAAAAAACCCACCTGANNCANTCNNNCAAGGGTCTGT
GCCCAANTGANCCCTTGTGGCCNAGGTGGCACCAACCTGGGCCCNTTGCCAACTNANTAAATTCCCCCACTGNNTTCNCT
CATCTAATCCTTTAATCCTCACTGAGGCAGGCCAGGCNGNTNNCAGGCAGGCTCTCGNANCTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14664H2HMR1
Sequence
ACCTCCCNNNNNNGGGTCGGTGNGGCTGGAAAAACAGCTCANAAACTCACGTCATTACAACGTTTGTATCTCTAGCTCTG
GGGGAATCTGAAGCCTCCGGTGTCTGCGTCACGTGCGCTCACGTGCGTTTACGTGCACATAACCTCATGGAAGCACGCAC
CTACATATAATTAAACACACACNAAAAAAATCTTANGAGGAAAAAAAAAGAGAATAGCATTGATTCCCTCCTCATGTCTC
CATCTCCCAAGTGCCAAAATTGCAGGTCATACCACATCTGGCTTATANTTTCCTATCTACTACCTGAAGGGAACAGTTTC
CTCTCCTTAAAAANCACAGCAAACCCCGAGGCTGCTGANAACGTGGGAAACCTAAAAGCGGTGTGATANCTTCTCCTTCT
GGGCCTTGATGCCACTCCAAGGGCAGGTTTGGGATCANTCCCCCACGTCCCTCTTGGAAGCGAGCCCTCAAGAGTTCANG
GN
Sequence Type genomic DNA
Unitrap ID UNI13261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97677885..97678342 434
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]


Sequence tag IST14664H2HMF1
Sequence
GGGTTATATGGCATTATCATCTCAGGACAACCAGAACAAACAAAAAAAAACCCACCTGAANCATTCNTGCANGGGTCTGT
GCCCAANTGANCCCTTGTGGCCCAGGTGGCACCAACCTGGGCCCCTTGCCAACTCATTAAATTCCCCCACTGTATTCTCT
CATCTAATCCTTTAATCCTCACTGAGGCAGGCCAGGCTGGTTCCAGGCAGGCTCTNNNANCTCCNAACCACCTANCNTGG
CNCANCTCANTGCCCCTGANGGACAAANTCTTCCCCTCTGACCCAGGGCATATNATGCCTCCTTCTCTATTGTTGGAACA
ACCCGTATCACTCANGAAAGCCAAACTAANNANATGGGAGGATGGNCCCCTCATACCNCCCTCCCTCNAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es