Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST403-3
Clone ID PST403-3
Vector U3NeoSV1
Project escells

Sequence tag PST403-3
Sequence
GCGTGCGCCACCACACCCGGACAGACATGATGTTTCATACCTTTATTCCTAACAGGATGATCTCTTGAGTTCATGTCTAG
GCCATCCTGCTCTACAGAGCTAGTTCCACGACAGCCTGGGCTATACAGAGAAACTAAACTCAGTTTTAAAAACCAAAACA
AAGAAATGCACACATGTAAACTGTTGAGTAACATTAGGTGGATAAAAAGATCAGACTGAAAGATGTGTTAAGGGAACCAC
TTTACTAGATGTTTTTTGATGGTATTCCTATTGGCTATACTATATTTAAATGTGAAATTGGTCTCATTCCTTTCTTTTGA
TTTTTAGTTACAGTCATCTACATAATTATTTTGAGGCAGGATCTCTACATAGCCTTGGCTGTCTTGGAACTATGTTG
Sequence Type genomic DNA
Unitrap ID UNI15735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 135119758..135120152 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030795 (Fus) NM_139149 fusion, derived from t(12;16) malignant liposarcoma (human) Gene [Source:MGI (curated);Acc:Fus-007]

 
Come back to gene ENSMUSG00000030795


For any suggestions or comments, please send an email to unitrap@crg.es