Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14482G2
Clone ID IST14482G2
Vector VICTR74
Project tigm

Sequence tag IST14482G2HMF1
Sequence
GGGTGACTGAAGCTCCCAGCAGAACCACTCATTTGGGCCATCCTGTGGGTATAATTTCCTTGTGTTTGTTCATTTGAGAC
AAGGTCTTGCTATGCCCAGGCTAGCCTGCAACTCGATAAGTAACCTAGGGTAGACTCAAACTCTCAATCTTCCTGCCTTA
ACCTTGAATATGTTAGGATTACGTGCATCAACCATCCCCAGCCTGGGCCCCTGGTTTANAACATCCTGGGAAGAAGTTTA
CACACCCTTTAAATCACCCAAAAGTACAGTCCANACATGCCACCCAGTAAACATATAAGGAAGTATATGATCTCCTAACA
GATTACTCCNAATTCACAGCCCACAAGGCTTAAAATGAGGCTACATAATGCTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96835630..96836004 369
 
EST/CDNA Est Name
  CV783214.1 - BX514039.1 - BY245563.1 - BB861764.1 - BY275643.1 - CJ088721.1 - BB849244.1 - BY133660.1 - D76669.1 - AI594990.1 - BY235074.1 - BY181980.1 - BY192884.1 - BY231416.1 - BY181800.1 - AA118973.1


Sequence tag IST14482G2HMR1
Sequence
ACCCGANCCGTTGGTGCTTCTCTGTACTGCTGTGCAGACTCAGGCATGGCCCATCTCCCTCCTGTCCTTCTTTCTCCTTT
CCTTCCACAGCCAACTCTCAGGTCTTTGTTTCTGAAATGTAGATGCAGTTCTGTCTCTTAGGGAGCTTTCTTCATTACCA
ACCAATGTTTTCATGANCAGCTTTTCCGAANACCCCAGGGCAGAAGGTTCTTTTGGAGCCTGGTGGGAAGGTAAAAGTGG
TTGAAAGTATGGGGCACGCCAGGCTAANCNNNAATGANGCTGGAGGAGGGGCTGGAGGAGGGGGTGGGGNTNNNAN
Sequence Type genomic DNA
Unitrap ID UNI5311

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96835325..96835633 293
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018678 (Sp2) NM_030220 Sp2 transcription factor Gene [Source:MGI (curated);Acc:Sp2-001]

 
Come back to gene ENSMUSG00000018678


For any suggestions or comments, please send an email to unitrap@crg.es