Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10219H9
Clone ID IST10219H9
Vector VICTR76
Project tigm

Sequence tag IST10219H9BBF1
Sequence
CCAGGACCACCTGCTGGGCCAATCATCCATCAAGAAAATGCTCCGCANACTGGCCTATAGGCAGCCTGATGGAGGTTAGT
TTCTCCCATTGAGTTTCTTCTCTCTAGATAACTAATTTATGATAGGTTGGCAAAAACCAAACCAGAACAACAGGGCACGG
CAGCACACTGTCGCTTTAGTATANGATTTGTTTTCCTGTTGGTAATTTTTGTTTGCATGGTCCAGTTTCTCTCTGTGTTC
AGGAATGAGTATCTCCATGGCGGTTTTCATGGACCTGGTGTGGAACACTCTTGCTCCTCTCCTCCCATGACTGGTGGCTG
GTGCTGAACAGT
Sequence Type genomic DNA
Unitrap ID UNI21596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82904060..82904390 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038172 (Ttc39b) NM_027238 tetratricopeptide repeat domain 39B Gene [Source:MGI Symbol;Acc:MGI:1917113]


Sequence tag IST10219H9HMF2
Sequence
TTCCACACGGTNACCCGTGCANCCTGCCCTCCGCGGAGTCCCGGNGCCAANAAGGCTCCCGCCGGCGCCTGTGCCNCANA
CCTNTCNNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038172


For any suggestions or comments, please send an email to unitrap@crg.es