Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14578B9
Clone ID IST14578B9
Vector VICTR74
Project tigm

Sequence tag IST14578B9HMR1
Sequence
CCCCCAGCTGCTTTATGGCCTTTTAAAATTACACAGTTGGGATATCCCCAGTGAACTTTGAAGTATGTTACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI29669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 43207145..43207219 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038214 (AK122525) NM_199028 BEN domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2677212]


Sequence tag IST14578B9HMF1
Sequence
GGGGAGATATGCCAGAATGCTAATTACTTCCAATTAGGAGGATTGTGGATGAGTCTTCAGAATTGCCTCTACTTTCTAAA
TATTCTATAGTAAGTATGTAACTCTTTGATACAGAAAATAATTGGTGGGGGGGGTTCTATTTTTTTACGTGAATATTTTT
TTAAAAAAATGTTTATTTTTANTTTATCTGNCNNANNACACAACCNNAANAGGAAATCAGATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038214


For any suggestions or comments, please send an email to unitrap@crg.es