Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11853D8
Clone ID IST11853D8
Vector VICTR76
Project tigm

Sequence tag IST11853D8HMF1
Sequence
GTTATGGTGGTTGAACTAAGTGGCTTCGCAGCCTTGCTTGCACCGGAACGCTCCTGAACAGGACTAATGCGTTCCGGCTC
CGCGTCAAGGCTGGCATGAAAATCGAACCCACGTCCTTGTGGCGCGATACCGAATACCGTCACGCGCACGCGCGTCTTCC
CGCAACAAACACTGCACACAGCGCTGGCCGGAAACACTTTGCAAACCCACATCTTTGACTTCCGCCCGAAGCTCTAGGTG
GGCGGGGCTTTCCGTGACCCAGCTCTCTACTTCCGGTGCGCGGGTGACGTAGTGCCTGCATCTCTTACTGCTGCGACACC
CGGAGGACTCTGAGTCTTCTGTCGTATACTTGCTCCCCTGCTTTTCTGTGTTTCGGTCAATAACACCGCCATGAACAAGA
AGAAGAAGCCGTTCCTGGGCATGCCTGCGCCGCTGGGCTACGTACCCGGGCTGGGCAGGGGGTAANGCAGTGGGGGGGGA
GTTTGCCCCNGGTNNGGTNCCC
Sequence Type genomic DNA
Unitrap ID UNI542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181335776..181336275 487
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002455 (Prpf6) NM_133701 PRP6 pre-mRNA splicing factor 6 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1922946]

 
Come back to gene ENSMUSG00000002455


For any suggestions or comments, please send an email to unitrap@crg.es