Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12398B5
Clone ID IST12398B5
Vector VICTR76
Project tigm

Sequence tag IST12398B5BBF1
Sequence
AAGGTAAACATTTTAACATTAAAATATTCACACGAGTGAAATTATTTCTTTAAATTTTGCTCACGATCTCAGTAAAATAG
GTACAATATTTCTTCACTTCTCTTGCTTGATCAGAGGCGTAGTCCAAACCTTTGCAAAAAGTTTGACACATCCCACTTTC
CGTCGACTCGCCGCAGGGCTTTCTGGGAATGGTAGTCCTAAAGTCTGTGTGCTCCAGCAACAGCCACGGCACTCGTTCCA
CGGAGGTACTACAGTGTGGCGCGCAAGTCTTGAGGCTCTTCCGCATTGCCTGCGCGCCCGCCTCAGTTATCATGGCGGCT
CCCTTGGCCCTGGTGCTTGTGGTGGCCGTGACCGTGAGGGCGGCCTTGTTTCGCTCCAGTTTGGCCGAGTTCATTTCCGA
GAGGGTGGAGGTGGTGTCCCCACTGAGCTCTTGGAAGANAGGTGAGGCCNCTGACTANAGTANGGGCGGTCGGCGCTCTG
CCNGCCTGTGAATTGAATTGGAN
Sequence Type genomic DNA
Unitrap ID UNI35445

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155182942..155183442 490
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038383 (Pigu) NM_001004721 phosphatidylinositol glycan anchor biosynthesis, class U Gene [Source:MGI (curated);Acc:Pigu-001]


Sequence tag IST12398B5HMF1
Sequence
AAGGTAAACATTTTAACATTAAAATATTCACACGAGTGAAATTATTTCTTTAAATTTTGCTCACGATCTCAGTAAAATAG
GTACAATATTTCTTCACTTCTCTTGCTTGATCANAGGCGTANTCCAAACCTTTGCAAAAAGTTTGACACATCCCACTTTC
CGTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155183279..155183442 160
NO GENE  

 
Come back to gene ENSMUSG00000038383


For any suggestions or comments, please send an email to unitrap@crg.es