Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15083G2
Clone ID IST15083G2
Vector VICTR80
Project tigm

Sequence tag IST15083G2HMR1
Sequence
CCTTTGGACCTGCAGACGAAAGACACACACACATTANCTTATTTTTAATATGCTTTTTAGTTCAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 149521138..149521203 64
NO GENE  


Sequence tag IST15083G2HMF1
Sequence
ACCCGGCCAGAGGCTCTGCATTCAACTCCCTGGCACCTCAAAACAATTTTTTTTTCCTCTCGAGAATCAATACNAAATAN
ACAGAGGCTGTACCTCNCGCCCTAAAAGCCCTACAGCTCCTATTTCAAGGTCTTCGGATGGCAGTCTTTTTTTGAGCCCT
GCGCACTTCTTTGGANATGANAAAAAAAAAGCTGCTGTCTGTGCCCGGTTAACCCTGATATTGTTATAAANATTGGAACA
GGTTATCTGTANACTTGACCTCCCCCACAAATTAAGGACAAAGGTGGCAAANATGTCCTTTGACACAGTCTCGTAAAGCC
GGTGTGTCCCATANCCTATCTCTTGNGCACTTTTCTTTGCCTGAANANGCACCTGGA
Sequence Type genomic DNA
Unitrap ID UNI7651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108564876..108565251 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032602 (Slc25a20) NM_020520 solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 Gene [Source:MGI Symbol;Acc:MGI:1928738]

 
Come back to gene ENSMUSG00000032602


For any suggestions or comments, please send an email to unitrap@crg.es