Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST118-1
Clone ID PST118-1
Vector U3NeoSV1
Project escells

Sequence tag PST118-1
Sequence
CAGCGGTGCCAAGAGAGAATGTCTGGCATAAGCATTTGAGGCTGAAACAAGCCCCAAAACAGGAGCTTGTTTGGTAGTGC
GGGGAGTCAGAGAGTACTGCTGCTCATGCTGACCTTTCCTCTGCAGATGGATGAGCTCCAAGGATCAGTGAAGCAGCTGC
AAGCCCTCATGGATGAGAGTACTCAGTACCTCCAGAAGGTGTCAGTACAGCTCAGTAAGTGCATCCTTTGAGGGGACCAC
GGCTGAGGGTTGGCTNTATCTGATGGATAGATAACCTTTGAGATGCAAACTGCCTTTCCAGACAGAAGTCCTTAGACTTG
TTATACTTCCCGTAGGAAGTCAAATATTGATGACAGGAAATGCCTCGNATGTAGATTCCATAGATGCACTCCATGAAGCT
NCCCAGTGTTTTTTGATAGCTTTAGTTTTCAAGG
Sequence Type genomic DNA
Unitrap ID UNI15738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 156822250..156822682 426
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027635 (Dsn1) NM_025853 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Dsn1-002]

 
Come back to gene ENSMUSG00000027635


For any suggestions or comments, please send an email to unitrap@crg.es