Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14116H3
Clone ID IST14116H3
Vector VICTR74
Project tigm

Sequence tag IST14116H3HMF1
Sequence
ACAATAAACAACCCCCCCCCAAAAAGTACCANGAATACNTTTAAAATCAAATATCTGTAACGCATTATNTGTTCCCTAAA
CCTGCTATNAAACCCCAAAATCAATGAATCATAAACTAAATCANCACACACNCNCNCNCNCCCNTNNNAAANCAAAANAN
CNCCCCNTNTGTANTAAAAAAANTCCTGAAATTTTTGGCCCTGCCCAAAANTNAAACTGTANCTGTCTTANCNCCNTGTT
TGANCNGGTCNCNGCNNNTTTTGANTTTCACACTGNCTTCNCCNNGGGCTTANTTNNCCGTAAATTTTTAACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14116H3BBF1
Sequence
ACAATAAACAACCCCCCCCCAAAAAGTACCANGAATACATTTAAAATCAAATATCTGTAACGCATTATGTGTTCCCTAAA
CCTGCTATCAAACCCCAAAATCAATGAATCATAAACTAAATCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109147331..109147452 118
NO GENE  


Sequence tag IST14116H3HMR1
Sequence
TNATTGNTTTGAGGTTTCTCTTTTCCCCCGGCTGTCCNANAACTCATGCTATAGACTANACTGTCCTCAAACTCAANATT
TGCCTGCTTCTGTTTCCTGAGTATTGGAATTAAAGGCACGCACCACCACTGCCAAGTTGTTTGCCTGGTATTTTAGAAAG
GGCAATTANTCATGANCCTGANGGTTTTTCACATTTATTTGTTTTGCTTGTAACNNNTTC
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109147448..109147659 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]

 
Come back to gene ENSMUSG00000000303


For any suggestions or comments, please send an email to unitrap@crg.es