Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13065H8
Clone ID IST13065H8
Vector VICTR76
Project tigm

Sequence tag IST13065H8HMF1
Sequence
NTAGGACATTCTGAGATGCTGAGGTCTAGGGATTCAGTATGTGGATTGCAGGGANGGAGGGAAGGAGCACAGTTCAGCCC
ATTACATTAAGGACTGGGAGAAACTTTCCAAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI14679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11765462..11765577 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]


Sequence tag IST13065H8HMR1
Sequence
NNTGATTCTTAANTNNCTTCTAAGAACAAATTATCACACTCTGAATCTAACATGGAATAGCATTATCCATGTTCAGATAT
CTTTGTCTCAAGGCTCAGGTTTATCCTTTGTAGCTTTCTTTTTGCTATCCCACCTCTATTCAGCATCCAGTCAAGGATCA
CTGAGTTGGTTATCAGTAAATTAAACATTTTAATTAATGTCTAGGAGACAGGTTATGGTATAGTTCTCAGTGCTGGGAAG
TTC
Sequence Type genomic DNA
Unitrap ID UNI10617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32612840..32613080 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022797 (Tfrc) NM_011638 transferrin receptor Gene [Source:MGI (curated);Acc:Tfrc-001]

 
Come back to gene ENSMUSG00000022797


For any suggestions or comments, please send an email to unitrap@crg.es