Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14780H5
Clone ID IST14780H5
Vector VICTR76
Project tigm

Sequence tag IST14780H5BBF1
Sequence
NTCTCACCTNACCANGTGCTGGTANAATAAACACTTGAGGACANATGAATANAANCCCNNGANGCATTTTCTGNANTGNA
AATANCCAGGCCCANGCNANGAATTAAACANCTATTGCTCATTCTCTCTTTCCCANNTCAAGGGAACTTCCTCCATGGTC
TCCCTGCTTTGCCCTGGCTCCCTTCACACANCAAACATGANCCTTTTAAAATTACNGGTCAAAAACTGTGATTCCTTGAC
TCNNAATCTTCCNNTAACTTTCTCTCTACACCTCCCCCACACACACCCTTGATATACACCCCANGCTGGCCTTGAACTCN
NNCATCCTGCCTCANCCTCCTGAATGCTGTGATTACNANTGTGTATCANCCCCCTCNNCNATCNAGTGATTTTTTTTTTT
TN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14780H5HMF1
Sequence
ACCTCACCTCACCAGGTGCTGGTAGAATAGACACGTGAGGACAGATGAATAGAAGCCCAGGATGCATTTTCTGCAATGGA
AATAGCCAGGCCCAGGCTAGGAATTAAACAGCTATTGCTCATTCTCTCTTTCACCAAGTCAAGGGAACTTCCTCCATGGT
CTCCCTGCTTTGCCCTGGCTCCCTTCACACAGCAGACATGAGCCTTTTAAAATTACAGGTCAAAAACTGA
Sequence Type genomic DNA
Unitrap ID UNI16383

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152632398..152632626 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]


Sequence tag IST14780H5HMR1
Sequence
AGGTCAGCAGAATCCACACTTTACAGAGAAGAAACCTGAGGCTCTGAGACACAAAGTCACCTATTAAAGGTTATACAGAA
AATCATCAAGAAATCTGACAACAAATGCTGGCAAGGGTGTGGTGAGAAAGGAGCCCTTACTGACTGTTGCTAAGGATGCA
TGCTAATACAGCCATTATGGAAATCNTAGGAGGGTTCTCAACAACTTTAAAATAGAGGTACAGTATGACCCAGCTATAGT
ACTGCTAGGCATCTGCCCAAAGAACTTCATATCCTACCACTGAAGTCCTTGTATATCCACAGTCACTACTGCTCTACTAA
CAAGGAAATGGGGCTAGCCTATATGTCCATCAACTAANGAATGGATAATGGAAGTGTGGTGTGTATATGTGTACACACAA
ATACATTANGTGTGTGNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152632623..152633038 410
 
EST/CDNA Est Name
  AI180733.1 - BE571429.1 - DT926332.1 - CF725764.1 - AA823283.1 - AI323048.1 - AA051441.1 - DT922788.1 - W97433.1 - CA546825.1 - BY017191.1 - CF170305.1 - DT928753.1 - CA884244.2 - CF166076.1 - BQ558343.1 - CD543337.1

 
Come back to gene AI180733.1 - BE571429.1 - DT926332.1 - CF725764.1 - AA823283.1 - AI323048.1 - AA051441.1 - DT922788.1 - W97433.1 - CA546825.1 - BY017191.1 - CF170305.1 - DT928753.1 - CA884244.2 - CF166076.1 - BQ558343.1 - CD543337.1


For any suggestions or comments, please send an email to unitrap@crg.es