Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST728-1
Clone ID PST728-1
Vector U3NeoSV1
Project escells

Sequence tag PST728-1
Sequence
CTCTTGGCTTTTNAGTTGCCATAGAATAACCCCGCCACCCAAAGGGCAGGATTTCCTCCATCCTAGCTCCTGCGTGTGCT
AAATGGTCCATGGGCCCCTGTGCCCTGCTCCCCCCCACAGGTCAGAGTCAGAGTTGGAATCAGGGCTACGGCAACTACTG
GAACCAGGGCTACGGCTACCAGCAGGGCTACGGGCCGGGCTATGGCGGCTACGACTACTCGCCCTATGGCTATTACGGCT
ACGGCCCCGGCTACGACTACAGTAAGTAGGAGAGGGAGGCCCTATCTACTTCCTCCTAGGGGAGGCAGGTTAGGTAGTGC
AGGGGCCATTGGCAGCAGGGGCTTTGGAGTCAGACAGGCCTGGCACAGGCACTGGAGCTACTGAATGAAGCTCTAGCTTA
GCCTTCTCAGTAAGGTGTAAGAAGCTGGTGTTGCTGTGTAGTGTT
Sequence Type genomic DNA
Unitrap ID UNI15743

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51415068..51415513 440
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020358 (Hnrpab) NM_010448 heterogeneous nuclear ribonucleoprotein A/B Gene [Source:MGI (curated);Acc:Hnrpab-003]

 
Come back to gene ENSMUSG00000020358


For any suggestions or comments, please send an email to unitrap@crg.es